Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig82
Contig Information
Length 676 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2d09    rwhrd2d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 620
Evalue 9.13014e-63
Total Hit Count 179
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig82
CGAGTATCAGCTAGAAGATTTTGAAATTATTTCTGCTGATTACATGTTGAAGGTGGGGGTTTCGAACTTCCGAAATGCTTGGGAAAGCATGGATCCGGAA
AGTGAGCGGGTCGATGAGTATGGACTCGGTGTTAGGGAGAGCTTGGCCGAGGCTGTGAGTGCTGTTATAAGCATCCTCGGCATGCAGCCTTGCGAGGGAA
CTGATGTTGTCCAAAACAATTCGAGATCGCACACTTGCCTGCTCTCAGGTGTGTTTATCGGTAATGTGAAAGTTTTAGTGAGACTTTCATTTGGAATCAG
CGGACCCAAAGAAGTGGCCATGAAGCTAGCAGTCAGATCAGATGATCCGGAGGTCAGTGACAGGATCCATGAAATTGTTGCGAACGGCTAAAACCACCAG
CAAGAGTTTTTTGGTTGACCTTTTTGTTTTAGCTTTCAATCTGCTGAAAGCACAAGGGATTTCGATTAATTATAGTATATGGCTATATGTAAGTTGGTTT
TCTCGTTGGAATCCCACTGTTGTTGCAGCACCATTCTCGTTCAACGCAGTAAAACACATTTTTGATTGATTTGGAACCACACTATTTTCTTATATCCTCC
TGGACTTGAAAAGTACATGCAATAATACTGAAATGGAATGTCCAATGCAATTTTAGCACTAAAAAGAAAAAAAAAA
page-top