Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig80
Contig Information
Length 877 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2c15    whrd18m10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RGA-1 [Triticum aestivum] >gi|156152306|gb|ABU54408.1| Lr1-like protein [Triticum aestivum]
Score 532
Evalue 2.38456e-52
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig80
ATCAAATATTTTGTTTTCAGACCTCCAAAAACTAAACTCACTGAGAAGTATAGTTCTACAGAAATGCGATGGCATATTTTCTGCAGAATTGGTTGACAGT
GTTATCCTCCATTCAGTTCGGGATCTTGACATACGTGAATTATGTATTACTGGAGAACTGTTTTCAAAGGTGTTGAAGTGTTTCCCAGCTCTTTCCAAAC
TTAGCATCTGTAGGTGTAAGAGCCTTGAACTTCTGACCGTGGAGGATGGAGGACTCTCGGACCTCAGGACGCTCCAATCGTTTGAAGCACTTTCTTGTGG
AAACATGTTCTCTCGATGGCCCAAAGGAGAAGTGGGTGGAGGAGCTCATGCCATCAAGCCTTTCCCTGCTTCGCTTAGGGAACTTATGATTTTCGTAGAG
CCAAGCATGCAGTCAATGGGTTTGCTCTCAAACCTCACGTCTCTCACCAGCCTGAGCTTGGAAACTTGTAGGAAATTAACAATGGATGGGTTCAATCCGC
ACATCACAGTCAACCTCAAGACATTGGCTGTATGTGGTTATAATGATGGACAAGGGAACATGTCTATAGCAGGAGATCTGGTGTCAGAGATTGCAAGGAG
CAAGTTAATGCATGTGGGTTCATTCCAGCTGGGAAAAATTTATGTGGACAACATCTCGGCAGTGCTTATTGCTCCCATCTGCAGCCACCTTGCCCCTACC
CTCCACACATTGGTGTTCAGTCATGATCAGGGGGCGACAACCTTCACGGAAGAGCAAGAGAAAGCACTTCAGCTTCTCACCTCCCTCAAACATCTTGAAT
TTCGAGTTTGCAAAAATCTGCAGTCCCTCCCTCAAGTGTTACGTCTCCTTTCTTATCTAAAGACACTAGTGATCCAC
page-top