Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig79
Contig Information
Length 1162 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2c13    rwhrd2c13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08923 [Oryza sativa Indica Group]
Score 790
Evalue 4.50444e-82
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig79
GCAGCGGGGGAGGAGAGGGGCAGTGCTGGGTTTATCTTCATGTGCAACGGAAAGACGAAGCCGGAGTGCTTCCAGAACAGCGTGTTTGGCTTGCCCAAGG
GGAAGATAGATGTGGTGGAGAAGATCCGACCAGGGGCGAAGCTGTTCCTGTATGACTTTGACCTGAAGCTTCTCTATGGGGTGTACAAGGCAACAGCAAG
AGGAGGGATGGATCTTGTGCGGCGTGCGTTCAACGGGAAATTCCCTGCTCAGGTCAAATTCAGGATTGATAAAGATTGTCTTCCGCTTCCTGAGAGTAGT
TTCAAGCATGCCATTAAGGAGAACTACAATTCAAAGGGAAAATTCACCCAAGAGCTCAATTCGAGACAAGTCCGTAAGCTACTGGCACTATACAAGCCAA
TTAACATACAACAGCCATCTTCCCAACATGTTCAAGAAGTTCCTCGGACAAACCGTGTTGAAAGGCGCATGCCTCACTATGTTGAAGAAAGGCGACAGCC
ATATGATTATGAAGAAAGGAGGCTGCCACGATATCGTGAAGAAATGCAACACCCACAATTTGCTGAAGAAAGGAGATTAGCCTATGATTATGAAGAAAGA
AGGCCATCACTCCATGTTGAAGAAATTCGACGCCCACAGTTTGTTGAAGAAGCTCAGCCACCTACATACTATGTTGCTCCTGCTCCTCATGGTTCATACC
ATCCACATCAAGCTAATATCATTTATGAAAGGGCTCCAGCTGACGCCGCCAACAGGGTGGATCCATTCCTTCCAAGAGACTACAGGGTGCCGCCACAGGA
GGTCGCCGCACCCCCAAGCTACGCTGATGAGATCTACCGTGGTGCTTACCCAGCTGCTTACCCGGCAAACCTCCAGGGGCCTGCTGCTTCAAGGGTGCCA
GTGTCCTCCCTCTACTCCTTCGCCGGCGCACCGGCGTACAGATGAACGCTGCAGCGCCTGCTCTGAAACCGGTCCTGACCAGCATGATTCGCTGGTTGGT
GGTGTAGCTAGCGTCGTCTTCTGATACATACTGTAGTCGTTTGTTGGATCCCTGACTTGGATGTCGTTTGCCACAAGTGTGGTACTGGAACGTGTCGTTT
GCCACAAGTGTGGTACCTGGAACGTGTCGTTTGCCACAAGTGTGGTGCTGGAACGTGTCGTT
page-top