Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig77
Contig Information
Length 1095 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1i23    rwhrd1i23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0133900 [Oryza sativa (japonica cultivar-group)] >gi|108706041|gb|ABF93836.1| serine O-acetyltransferase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547350|dbj|BAF10793.1| Os03g0133900 [Oryza sativa (japonica cultivar-group)]
Score 1176
Evalue 7.18568e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig77
GTCCGAGGCAGAGAAGGAGCCTATTTTAAGTAGCTTCTTATATGCGAGCGTATTATCTCACGACTGTCTGGAGCGGGCGTTGAGCTTCGTCCTTGCAAAC
AGACTTGAAGATCCAACCTTGCTTGCGACTCAGCTAATCGACATTTTCAATGACGTCATGATGAATGACGTAGATATACGCCGTTCCATTCGCCTTGATG
CTCAGGCCTTCAAAGGAAGAGATCCTTCCTGCGCACAATATAGCTGGGCCCTATTATACCTAAAGGGTTACCATTCCTTGCAGTCCTATAGGATAGCTCA
TGTATTATGGAATCAAGGGCGTAAGGTTCTGGCGTTGGCGCTGCAAAGCCGTATCAGTGAGGTTTTTGCAGTGGATATACACCCAGCTGCCAAAATTGGA
GAAGGAATATTGTTGGATCATGGAACAGGTCTAGTCATTGGTGAAACTGCTGTTGTTGGCAACTGGGTTTCATTAATGCAGGGTGTTACGCTTGGAGGTA
CTGGAAAGGAACACGGAGATAGGCACCCCAAGATCGGTCAGGGAGCTCTTCTTGGAGCTGGTGCTACCATCCTTGGCAACATAACTGTAGGCGAAGGTGC
CATGATTGCCGCTGGTTCCCTTGTTTTAAAGCATGTACCGCCTCACAGTATGGCGGTAGGAAATCCTGCGAAGGTAGTTGGCTATACAGAGAAAGAAGAT
CCTTCGTTGACTATGAAGCATGATGCAAGGAGAGATTATTTTGAGCATGTTGCCGGTAGTTTTCCTGACAGTAGATCCAACGGAAGTGTCGTGAAATAAA
AAACTTGCAAGGAGGAATGGAATTTTGGACATTTCTACATCCTGGTGGACGTACGGCGCTGGATATTTGGCGACGCCCGAGTGGTGCTTCCCCCTGCCCA
GCAACCCTCTTGTGAGATCATGCAGGCGAGCCCGCCAAGGGTCTCCGGAAGCTCCCCAGATGTATTTATCATGTGCCCTTAAACTGATGCAATAATGTGA
AGATGTTTTCTGTAAAAACTGGAAGGAGTGGTACAGATATATAATCTGTAGAGATCTCCAGCGGCAAGCTGTAGATACCTCAGATTCAGAGCGTG
page-top