Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig75
Contig Information
Length 669 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11o20    rwhrd11o20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein l34 [Triticum aestivum]
Score 491
Evalue 8.03427e-48
Total Hit Count 305
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig75
CGGGAGCGAAAGAGCAAGCGGCGAGAGAACTCCGGGAGAGGGCGGCGAGATGGTGCAGCGGCTGACATACCGAAAGCGCCACAGCTACGCCACCAAGTCG
AATCAGACTCGCGTCGTCAAGACCCCAGGTGGGAAGCTTGTCTACCAGTACACCAAGAAGCGGGCGAGTGGGCCAAAATGCCCGGTTACCGGCAAGAAGA
TCCAAGGAATCCCACACCTGAGGCCTACTGAGTACAAGAGGTCCAGATTGTCGAGGAACAGGAGGACTGTGAACCGTCCTTATGGTGGTGTTCTGTCTGG
TCCTGCAGTCAGGGAGAGGATCATTAGGGCGTTTTTGGTGGAGGAGCAGAAGATTGTGAAGAAGGTGCTTAAGATCCAGAAGACCAAGGAGAAGACCACC
AAGAGCTAAACAACTGGGCGAGATAGGCGTCGCGGTGATGTTTTGTGTTTCTCCGAATTTGTTTTAAGCAATCAAGAATTTTCTCTCTTGGGATTTGCAG
AATCCTGGTTCTAGTATGTGAGGTTTGATGTGCTTCTCTAGATTTTGCGCCTGGTTCTCTATGGATGCTTAGCCTTTGATGCAAGAGCTTTCGGGCTCCA
ATTCGGCTTAGATGCTCTGAGCTGCTTAGCTCAGTTAACGCTGTCAGGCTTTATTTGTCAAAAAAAAAA
page-top