Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig74
Contig Information
Length 743 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2b05    rwhrd2b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_026335 [Oryza sativa (japonica cultivar-group)]
Score 608
Evalue 2.73312e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig74
GGGCATTGCATATATGATGGTGGTTACTGTAAGCTTCATCTGTCATACTCTCGTCATACTGATCTGAATGTGAAGGCACATGACGAGAGAAGCAGAGACT
ACACCGTCTCGGATCCTAGTGCTCAGGTACAAGCTGCAGGTCAAGCCCCTGGTCTAAGCACTCCTGGAGCAGCATGGCAAAGCACCACGCCTGCTGCTTT
TTATGGAAGCTCAGCAGGACCGACCTCTATCGGACAAGCGCCAGCCTGGAATCCTAACATGCAGCGAGGGGCATTTGCACCTGCATCAACCTCGTACCCT
ACCCAATTATTGATGGCAAACCCAGGCCCGCACTTTCCAGCAGTCGGATCAAGCTCTGGTGCTCCTCCGATGTTGTACCAAGCTTCGCAGCAGATGGCAC
ATTATGGCACAGCCCCTGCTGCTCTGCCTCATGCAGCCTTGTCTGGCGAACCGATGTACTTCCCAAAATGAGCTATTCATCCAATAGAGCAGTTGCCTAT
GCTTTGTGCAGCACCTCTGGTCTTCAATTTTTGGAACTGCACTGTAATGCCGATCTGTTTTTCTTGGTACTTGTGAGACCCCTGTGGCAAATGTACCTGT
CTGGCTGTTGGTGCCTGTAAACTGCACAACAAAATGGAAAATTACTCGAGCCATGTCAGTTCAATCCAAAACCTGATGTTCTTTCTGCGCTTGATAATTA
CTTGGTACAAGGCACCAACAATTAAGTTTGACTAAAAAAAAAA
page-top