Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig72
Contig Information
Length 366 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2a10    rwhrd2a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit equilibrative nucleoside transporter, putative [Pediculus humanus corporis]
Score 80
Evalue 1.56276
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig72
GGCGGTAGCCGCTTTGCCCCATCCTATTTATTCGTTCCGGTCGGCTGGCGGGTGTTGTTCCTAGGTTTCTTCCTCTTGTGTGACAGAAAAGGCATAGGAT
TTTAGGTGGGGGCGGGTAAACGGAGATTGGCTCTGGATGTTGTGCATAGTGACTGGTGGGATAAATCTGCATATTTGCAGGTAGTGCTTGGCTATTTCTG
TTCTTTTCTTTTTGTTTCTTCGCAAATGTAGAAAGTAGGTTGTGTCAGCCTGTCAGGCAGACCTTTGCCTGCCTGCATAGTTGAGGTCGTGCCGTTGAAG
ATGCGGAAATTGTGTAAATGGAGAAAGTTTCTCTCTGTTCATGCTGTGGGTGATCTAAAAAAAAAA
page-top