Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig71
Contig Information
Length 866 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2a06    rwhrd2a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 132
Evalue 5.60949e-06
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig71
CGCGGAGCTCCAGCGCGTTCGCGCCGGCTACGGCCCGGACACGCCGCCGTTTTCGACGGGGGAGGAGCGCGACGAGGGCGGAGCAGAGCCGTCGGACGAC
GACGACGACATTGCCGACTGCCGACAGGGATTCGAGAGCGACCTCGGCGACGACGACGATCAACATCACCACGTTTACGACGAGGAGGAGGAGGAGGAGG
AGGACGACGACGACGACCCTGATCGGTACCACGGCGTGTCGGCCGTGGAGCTGGAGAGGAGGCTGCACGAGCTGCTCCACCAGAGGAACCAGGAGCGGAT
CGAGGAGCTGGAGGCGGCGCTGCGGCGCGCCGAGAAGCGGCTCTTCGACAAGGAGATGGAGGCGTCCCTCTGGAAGGACACCGCCAAAATGGCCTTCCGC
CACGACCACCACGACGACCACGACGACGACGACTCGCCGTAAACTCATGAGGAATTTCGTGCGGTCCTTTTTGTCGCCATTATCATCGATCGGCCGTGCA
TTACATGATTACGGATGAAGCCATTAGCCATGAATGGAGGCGAATTTTGGGACCTTTAATGCGTGAAGAAGCAGGCAATCGATCGGTGGTGGCGTCGGAT
GGATGGTGGACTGTAGGACGGGCCTTGTGTACAATATGTCACTACTGTTAGCAACTTATAGCTGGAGCTGTTCATACCGCCAGGGTTTAGACTCTTGGCA
CTGTAGGTTATTACATGGGCATGGCTGGGAATAGGATGGAACAGGGTAGGATATGCTCAGCTAGCAGCCTCACTGATTTTGTGATCCATGTAATGCAATC
GAGTTCGGTGTCTGTTCGTGCATATCACTCGTGTGCAGTTTCAGAATCAGGACAGCAGTTTCACAG
page-top