Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig70
Contig Information
Length 712 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10g06    whrd8j14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18555 [Oryza sativa Indica Group]
Score 1136
Evalue 1.4733e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig70
ATCAGGCGGCGCAGCTCGGTCTTAAGACCACCTGCATCGAGAAGAGGGGCGCGCTCGGGGGGACCTGCCTCAACGTCGGCTGCATCCCGTCCAAGGCTCT
TCTGCATTCGTCGCATATGTACCATGAGGCAAAGTCTTCTTTTGCACACCATGGCGTTAAGTTCTCCAATCTGGAGGTAGATCTGCCTGCAATGATGGCT
CAGAAAGACAAGGCTGTTTCTGGGCTTACAAAGGGCATCGAAGGCCTGTTCAAGAAGAACAAGGTTGAGTATGTTAAAGGGTTTGGGAAGCTTGTCTCTC
CGTCAGAGGTATCTGTGGATTTAGTTGATGGTGGTAGCACTATCGTCAAAGGGAAGAACATAATTGTCGCCACTGGCTCAGATGTGAAATCTCTCCCTGG
AGTTACAATTGATGAGAAGAAGATTGTGTCATCTACTGGGGCTCTTGCACTTACAGAAATACCAAAGAAGTTGGTGGTCATTGGAGCTGGATACATAGGT
CTAGAGATGGGTTCTGTCTGGAACAGGCTAGGGTCTGAAGTGACTGTGGTTGAATTTGCCCCTGATATTGTCCCATCAATGGATGGAGAGATAAGGAAGC
AGTTTCAGCGTATGCTGGAGAAGCAAAAGTTTAAGTTCATGCTCAAGACAAAGGTAGTCGGGGTCGATACTTCTGGAAGTGGTGTCAAGTTAACTGTGGA
GCCTGCAGCTGG
page-top