Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig69
Contig Information
Length 640 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2a04    whrd14b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37697 [Oryza sativa Indica Group]
Score 1033
Evalue 1.03221e-110
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig69
GCGGCGGTCCCAAGGTCATCTTCTGCGGTGTCATCCAGTACGCCAATCTCGTCGGCGTCGCCATTGGCTACACCATCGCCTCCTCCATCAGCATGCGGGC
CATCAGGAGGGCCGACTGTTTCCACGCCAACGGACACGCGGACCCGTGCAAGAGCTCCAGCAACCCATACATGATCCTCTTCGGCCTCGTGCAGATCGTC
TTCTCGCAGATCCCCGACTTCGATCAGATATGGTGGCTGTCCATCGTCGCCGCAGTCATGTCCTTCACCTACTCCGGCATTGGACTCTCCCTCGGCATCA
CCCAGACCATATCCAATGGTGGAATCAAGGGCAGCCTCACCGGCATCAGCATCGGCGTCGGTATCACGGCCACACAGAAGGTGTGGCGCAGCCTGCAGGC
ATTTGGCGACATCGCCTTCGCCTACTCCTTCTCCAACATCCTCATAGAAATCCAAGACACGATCAGGGCGCCGCCGCCGTCTGAGGCGAAGGTGATGAAG
CAGGCGACGCGGCTGAGCGTGGCGACGACGACGGTGTTCTACATGCTGTGCGGGTGCATGGGGTACGCGGCGTTCGGTGACGCANCCCCCGACAACCTCC
TCACCGGGTTCGGATTCTACAAGCCCTTCTGGCTGCTGGA
page-top