Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig67
Contig Information
Length 771 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10n05    rwhrd10n05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04752 [Oryza sativa Indica Group]
Score 140
Evalue 5.42964e-07
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig67
CCGTCTTTTCTGCAGAGGTTTCCGGCGGCGTCCTTTGCCGGCAACGGCAACGACGGGCTCTGTGGCGCTCCGTTGGATCGTCTTTGCCCCGCCTCCGCGA
GGAGTGGAAAGCAAATCAGCGGCGGGTCGAGTGTCGGGGCGGCTGTCGGGTTCGTCCTGGGCTTTGTGGTGGCCTTCTACTTCCCGCAGTGGTTCGTTTT
CTCCCGGAGGCTCCACCCCTACGTCTACCGCTTTCTCTGAAGCTTCCTCGTTCATGGAATTCCAGGAAGCCGGATGGGCACTTTGGACTATGGTTTCAGC
TTTTTTCATGGCGGCAACGTATATAGATTTGTCTTCATACATACTATGTGAACCTTGGCACTGCGTTTCTGTCAGGCACAACCCAAGAAGCAGAGCAATG
CACAAACCGCAGCACACAAGCATCGTTGCAGATGGTTTAGCGACCATGGGAATATATGATCTTGATTCCCATTTCTGTCGACCATGGGAATATATGAGCG
AGTGGCAGATGGTTTAGCGACTGCATGTTCCCGCCAACGCCCAGCATCGTTGCTGTACGCAGGAGCTGGCCCTGCATTGATTGATGTATTTTTACACTCA
AGCTCACAATGTGACACTGAGATTAGCTCGTACATCTATCATCTATGAATCATTGTAACGAACAGAGCAATGCATCTAAACACTGTCCTGTTTCCGTCGG
GAGTCCTTTATAATAGATCAAGAAGCGTTAGGGCTCTCTGCTCTGCTCTGCTCCAAAATACTTTCGTGCTG
page-top