Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig66
Contig Information
Length 395 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1p02    rwhrd1p02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 76
Evalue 4.5379
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig66
CAACATCGTCTTCCTCGTCTTCATCGGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTACAA
GCAGCAGGGCGCGTACGCTTGATCGCGCGCTTGGCTCGGTTATTTATTGCTTGGATTGGATGGATGCGATCGTCTCGTCGTGTCATGCATCTTCGTCGTC
GTGTTTCTCTTAGGATGGCCTGATCTAGCTTTGTACAGGCGAGATGTGCTCTGATCACCTACTAGTTAGGTTTTACTCCGTGGTCATGAGGAGGGATGTG
TATATATATTTTCTGTTCTTTGATATTTATTATCGCAGACCATTATATATGTAACAGATTATTCTGGAGTTATTTATTTCATATTAAAAAAAAAA
page-top