Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig65
Contig Information
Length 674 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1n18    rwhrd1n18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Probable prefoldin subunit 4; AltName: Full=VIP3 protein >gi|6996146|emb|CAB75507.1| VIP3 protein [Avena fatua]
Score 515
Evalue 1.35309e-50
Total Hit Count 162
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig65
TTTCTCTCTTTCGTCGCTTTTCTCCACTCCTCTCTCGCCCCCCTCTACTGCCCGAAATCCAGCAGCGACCGCCGGCGCATCTCACCCCGGGCCGAGGCCG
GCGAACTCCGAAGGGAATCGGAGATGCAGCAGGGCGATGGCACGGAGGCGCAGGTGACGTGGGATGACCAGCAGAACATCAACCGGTTCGGCCGCCTCAA
CAACCGCCTCCACGAGCTCGCCGACGAGATCAGGCTCGCCAAGGAAGCAAACGAAAACCTCGAGGATGCTGGGAATGAACTCATCTTGTCTGATGAAGAC
GTGGTGCGATTCCAAATCGGGGAAGTGTTTGCCCACATGCCAGTGGACGATGTGGAAGCTAGGCTAGAGCAGATGAAAGAGGACGCAGCTAAGAAGTTGG
AGAAGCTCGAGGAAGAGAAGGAATCCATCCTTGCCCAGATGGCCGAACTGAAGAAGATCCTCTATGGGAAATTTGGAGATGCCATCAACCTGGAGGAAGA
TTGATGTCAAGAACTGGAGCTGCCTTTTTAAGTGTCGAGTCATATGACACCTGTTCTTGTTCAGGTGTTTCATTCGCCTCGTTGCATTGTTTCTTGTGAT
GCTGGCTAGTGTAAAATGGGAGTTTTAAGTTCTAGAGGATTGTTCCCCGTTATGCATTGGCATGGTTGATCTCG
page-top