Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig64
Contig Information
Length 983 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1m16    rwhrd1m16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative phosphatidylinositol 3,5-kinase [Oryza sativa (japonica cultivar-group)] >gi|108708656|gb|ABF96451.1| phosphatidylinositol-4-phosphate 5-kinase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 838
Evalue 9.48975e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig64
ATGGATGTTCTGGCCATGGAAAATCTTTTATTTGAACGTCGTGTGACAAGATTATATGATTTGAAGGGCTCAACAAGATCAAGATATAACCCTGATTCAA
ATGGTAGTGATAAAGTACTTCTTGATGAGAACTTGCTTGAAGCGATGCCTACTTCCCCTATTTTTGTCGGGAATAAGGCAAAGCGGCTTCTGGAGAGAGC
TGTTTGGAATGATACTGCATTCCTTGCTTCTATTGACGTAATGGATTACTCTTTACTTGTCGGTGTTGATGAGAAGAAGCACGAGCTTGTTATGGGAATC
ATTGATTTTATGAGGCAATATACGTGGGACAAACATCTAGAGACATGGGTGAAAGCTTCAGGAATATTAGGTGGACCAAAGAATGTATCACCAACTGTAA
TTTCACCAAAGCAGTACAAAAAGCGTTTCAGGAAAGCTATGTCAGCCTACTTTCTTGTTGTCCCAGATCAATGGTCGCCTGCAGCAATTATCCCTAGCAA
GCAAGTGTCTGACAGCGCCCAGGATAGCGATCAGTTCGTCTCCACGGGATCATCATCCATGCTGGACTGTTGAGATGCAGGGAACTGTCGTGGAATAACT
ACTACTTTTCTTTTGATGACGTATATATATATATATATTTTGATTCGTTGCAATTTTGCTCATCCATTTTACTGGGCCGTATTTTTCCGGTGCCTTCATT
CTTTTCTTCTTTGGAAGATCAAGATGTACAAAATCAAGCTGAAGTTATAGATAGAAACTTAACAAGTTTATAGTGTGTATAAACATTAGTTTAGTGCCTT
GAGGTATCATGCCCTGTAGAAAGAATCGAATCATTTTTGTTACCATTGTAGACAATATTTTACTTGTTATTTTCTACCCTCTCTGCCCGAATTACTTGGA
TGTATCTAGACAAATCCAAGACAAGTAATTTGGGATGGAGGTAATACCCCCCTTAAAGAAATATAAGAGCATTTAGGTCATTA
page-top