Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig62
Contig Information
Length 852 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11n10    rwhrd11n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|50725532|dbj|BAD33001.1| hypothetical protein [Oryza sativa Japonica Group]
Score 529
Evalue 5.10105e-52
Total Hit Count 102
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig62
TATTTTCTGCTTCTCCTCCTCTCATTAACCACTAGACAGCGAAAAGCTTCAAGCTCAGATATGGCTTTCCACCAAAGATCGATTAGTTTGCCTTCTAGGC
CTCACGTCGGTGAGACCGAAGTCGAGGAAGAGCTCCACCTCCTAGAAGCAAGCATCTCTTCCTCCAGTTCCATCAGCACGATGTGCGATGGTCTCAGGAG
TCTTGCAAACATCTACGATGGTCTTGAAGAGATTATTTGCCTACCAAGCAACCAAGTTTGCTCCTCCCAGAAGAGGAAGATGTTGGATGGAGAGATGGGA
TGCTCTGTTGAGCTGTTAGATCTCTGCAGCAACATGCAAGAGACCTTCGCCGAGATGGTGGTCATCATCCAAGAGTTGCAAGCAGCTCTAAGGAAAAGAG
ATGATGCAGCTGCTCAAGCCAAGATCCAGTCTTTTACTCGCTTGGCGAAGAAGGCCAGGAAACATTTCAAGAAGTCTGCCAAGAAGCCTGCATTCGACAA
GATGGTCATCCTATTGACCAAGGCAAGAGAGATCAGCATCTCTCTGTTGGAGTCCACACTCCATCTCTTGTTGAAGCAAATTGAAATGCCAAAGCAGTCT
CTTGTCTGCAAGGCATTTTACAAGAAGAAGGCAATTGTCTGCAAGGAGGAGCAATTGCAGGAGTTAGAGTGCAGTATCGAAGATCTTCAGAATGGAGTAG
GAGATCTGTTCAGGAAATTAGTCCAGAACAGAGTTTCTCTTTTAAACATTCTTAGCTCATAGGTAGTCCACATCACTCTACTCCCTCTGATTGGCGTCCG
CCTTTTTGAGGATGAGCCGATCTTGATACCAGTTTTTCCATATGTATAGAGT
page-top