Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig60
Contig Information
Length 1161 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10n08    whrd20n08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0439100 [Oryza sativa (japonica cultivar-group)] >gi|113564438|dbj|BAF14781.1| Os04g0439100 [Oryza sativa (japonica cultivar-group)]
Score 1350
Evalue 5.20222e-147
Total Hit Count 225
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig60
GCATCGAGCGTATGGACTCTGCTCTCTCCGATGCAAGATCAAAGTTCTTTGAAGCGAAGGAGAATGGAAGTCCATTGGCAGCACCTGTTGCAAACGTATC
TACCCCTCTGAGCATTGATTCATCTGGAAAGCTCCCGCCTACTGAGGTCAATATGAATTCCAAAACAGATGCTGAAGGATCAAGGTCTGTTGTGCGATCC
CTGTTTGGAGCTTCTGGAGCATCAAGCAGCACATCACCAGTGAATCTGCCAACAGAGAATGAGCAGATGGTCAATGAGATGCTTCATGAGGACGGTGGTG
CGATTGCTGGCAATTCTAATGATGCTCGTACCATTGAGAAGGGTTTCCAAGACAAAGTGAGGGAAACAATGGAGAAAGCTTTCTGGGATGTGGTTACCGA
CTCGATGAGAGGAGACAAACCTGACTACAGCCAACTGATCAACCTGGTAAAGGAAGTGAGGGATTCATTGCACGACTTGGCTCCCAAGGAATGGAAGGAG
GAAATCTGTGAGAACATTGACCTCGAAATTCTATCCCAGGTACTCAAGTCAGGCTCCCAGGACACCCAATATCTGGGGCAGATTTTGCAGTACTCTCTGG
ATATGGTCAGAAAGCTGTCTGCTGCGGCAAAGGATGATGAGATGAAGGCAAGTCATGACAAATTATTGAGCGAGTTGGCTGCAAGTTCTGAAGATAATGA
TAATGGAGTCAGCTCGTTCGTCATTGCTGTTATCAAGGGCCTGCGTTTCACTCTGGAAGAAATAAAGCAACTGCAAGTAGAAGTGAGCAAGGCATATGTT
CAGCTGATGCAACCGACGATAAAAGGCTCTGCTGGAGTGGAGTACCTGCAGAAGGCTTTCGGCGATCGCTATGGACCTCCTGCCAATGCGTCAGCTTCTC
TCCCTGTAACTCTGCAGTGGATTTCAGCATCAAAGAGCATCGTGGACGCAGAATGGAGCGAACATCTGGGCTCTCTTTCAGTTCTTCCAGCAGCAAATCA
TGCTCAGCCCCTTGTTACAGTGCTCCGAGCTGGCCATGGAGCTCCAGCAGCTGCTGTAGCTTCAGCAGGTAGTTCAGGTTTACCTGAATGCAAGGGAGAA
AAGATTGACAAGCTTGTGAGGGTTGGCCTGTTGCAGCTTATTAGTGGTATGGAGGGATTAC
page-top