Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig59
Contig Information
Length 1318 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1l14    rwhrd1l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoesterase [Zea mays]
Score 1278
Evalue 1.39279e-138
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig59
GTCCGAAGAAAGCAAAGGTTTTGCCTAAAGCAGAGGTGGCAGAAAAAGGAAGTGTCTCTGTTGAATACGCCAAGTCCGCCCGTTCCACGTGCAAGACCTG
CAATGCAAGCATCACCAAGGGCGCTCTTCGCATTGGCGTCTCAGCCCATGACCCCCGTGGCTTCGACAGCACCAAGTGGTACCATGTCGCCTGCTTTCCC
ACCTCGTCGCATCCGCTAGGCCCTGTTGAGAAGCTCAAGGGGTTCGAATCCATTAAGGATGACGATCATGAGGAGTTACGGGAGCTAGAGAAGAATAAAA
AGGGAGACCAGGCTGCAGTCGGTCCAGTGGAACTATCAAGTCCGAACAAAGGAAATTCCCATATATCTTTACCTGAAGTGGAGGTGGCTGAAAAGTCGTC
TCCAGGGAACAAAACAGTTGGTACAGCGATACCCTTTTCGCCTTCTGATATCAAGAAAACATACAAGGATGCTACCCTTCCCACTCATTGGAAGGCTTTT
GATACCGTTATTTTCCGTGAGCAGGATGATGGCCTTCATGCTTCAGCTAAGATTGCTGCGTTTGATTTCGACGGGTGCCTCGCCAAAACCTCAGTGAAGA
TCATTGGTGCAGACAAGTGGTCTTTACAGCATAAATCAATTCCTGACAAGCTGCAAAGCCTGTACAATGATGGCTACAAGTTGGTCATATTCACCAATGA
GTCAAACATTGAGCGCTGGAAGAATAAGCGGCAGCAAGCTGTTGACTCAAAAGTTGGACGCCTTGACAACTTTATTGAGTGTGTTAAAGTCCCTATTCAG
GTTTTCATTGCGTGTGGTACTGGGAAAGGAAAAGGCACACCGGATGATCTGTTTCGCAAACCAAATTCAGGAATGTGGTGGTTGATGGCAGAGCATTTCA
ATTCTGGAATTGCCATCGACATGGACCAATCTTTCTATGTTGGTGATGCTGCTGGGAGAGAGAATGATCATAGTGACGCAGATATAGAATTCGCTAAGGC
CACCGGTCTGAAGTTTCACGTTCCTGAAGAATTCTTCGGTCCCTAGCCGTTCACTGTGAGCAGCTATGTTAGGTGGTGAATAAGATGGTTTACCAATTGC
CGTAGGTCGGTGTCTCATGTTTGGAACCTAAGAATGCCACAGTTATTCTTACGTTGCAAGATCGCTGTTTAAACTTGCCGTAGACCTTTGCCGTAGTATC
ATGCCTGTTCGTCTAGGATCGACTTGAATCAATGTACTGGAGGCGGTGAACTGTTGGGATCTGAGTCAATGCCATACTGGGACTCGTCGATCACTGATTT
CTATCGCCCAGTGACTCA
page-top