Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig58
Contig Information
Length 597 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11m24    rwhrd11m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR80 [Triticum aestivum]
Score 160
Evalue 1.48571e-09
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig58
ATTGCAAAGAAAAGGAACTAGCTGTCAAGAGTCTTGAAATCAGTTCATCGTCATGTCCTCCAGTTTCTTCACCATTTACCTTTGACAACCAAGACAAGTA
AACAGCAGCACTAGCTAGTAGATTTCCCGAGTGACAGGTTGAGCGCAAGATGGAGCACCAGGGACACGGCACCGGCGAGAAGAAAGGCATCATGGAGAAC
ATCAAGGAGAAGCTCCCCGGTGGCCACCAGCAGACCGCTGGCACCCACGGGCAGCAGGGACACACTGGAATGACCGGCACGGAGATGCATGACACCACGG
CCACCGGCGGCACCTTTGGGCAGCAGGGACACACCGGAACGACTGGCACTGGGACACACGGCACAGCCGGGACCGGCGAGAAGAAGAGCCTCATGGACAA
GGTCAAGGAGAAGCTGCCTGGACAGCACTAAGCCCGGTGTGCCCACGACCGCTACCTTCGCAGAATAATACTCCACCGTATATGAATTGATCGAGTCTAG
TTCACCTAGCTCACTTGGTCATTGGAGGAGCGAATGTATCTTTGCTTTAAGTTTTCACGGAAATGTGTTCACTGTTTACGTTTGTTTAAAAAAAAAA
page-top