Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig57
Contig Information
Length 524 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1k19    rwhrd1k19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34071 [Oryza sativa Indica Group]
Score 355
Evalue 2.57914e-32
Total Hit Count 268
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig57
GGATGATGTGGTTATTCAGTTTCTGAATCCTAAAGTGCAAGCTTCGATTGGTGCTAATACATGGGTGGTCAGTGGAACTCCACAGACAAAGAAACTGCAA
GATCTGCTGCCATCAATTATCAATCAACTTGGTCCTGACAACTTGGACAACCTGCGGAGGCTCGCAGAGCAATTCCAAAAGCAGGTCCCTGGTGGTGCTG
CTGGCATCGAGGCTGGTACCAGTGCAGGAGCTGCTCAGGCTGACGACGACGATGATGTTCCTGAGCTTGTCCCTGGAGAGACATTTGAAGAGGCCGCTGA
AGACAAAAAGGCAGAGTCGTGATTTTGATGCATGTTTACTGTTGTGAAGGGTTATAAGTTAAGCGGCGCCATTAGAGACCACCTCCCCTTTCAAGAATTC
TGACCTACCTTATTTGTGCCAGTGGACCGGTTTTGTAATGTACGCGAGTTTCGTCTGATATGTTGGTGGAATTTTGCATCAAATTACATGCCTCTTTTGG
TTGCCCTCATTCTCAAAAAAAAAA
page-top