Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig53
Contig Information
Length 950 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1j20    rwhrd1j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17662 [Oryza sativa Indica Group]
Score 766
Evalue 1.9976e-79
Total Hit Count 255
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig53
TGCTGTCGATCTAGAGTACCCCGTGGTCCTCGGTCCACCTTGTACTATCGTACTGGACATTCTTTCCAAAGGAAACAGGGTTATACACAGAGCCAGAGCA
CTATTCTGAGGGGCAGCACCTCCCCTCCAACCATGAACCCCCATGCTGCTGAGTTTGTGCCTGGAAAAACTGTGCAACAAACTGATTTGGCTGCAGGGGA
ACAAACTAATTCTGTAAGTGATCCAGCAGATCAGCAGTTGGCATCACATGCCTCAGATGGAGTGAAAGTCGATGTTCGTGAGGCAGACAAGGCAGGTCAA
GTGGAGAAGACAACTCCAGGTAAAGTGAAGGAACGAGCGAAAGAGGCGACAAGAGATTCATACAAAGCAGAACTTGCAAGGCAGATTCTGCTCAGCTTCA
TTGTCAAGTCGGTCCATGACAGCTTAGGTTCGACTCGACCTCAACCGGACAGAAAACCAAGCGGGTCAGATGAAGCTAGTAACGAACAGAGCAGCAACGT
AACCAAGACTGCCGTAAGTCCGAAAGAGTTCGACAAACAACCGAAGGCCGCCGAGGTGCCCAAGAGCGAGAAGGATACAGAGGGGTTTACAGTGGTCTCA
AAGCGTAGGAAAAGCAAGCAGCACTTCGTGAACCCCATAAACGGTCTCTACTCTCAGCAGTCAATCTGCACTTCGGTCAGCTGAGAGGTTGCTGCGCTCC
CTGAGACCTGCAAGCAGTGCAATGTGTTGGAAGATGGTATTGCTTACTTTGCTCTTATTAGGCGCTTGGTAGCAGAGTTTTGCCCTATATTCAGATGAAC
GAGCATGTTGTCAAACTGTACAAAGTTTTCCGCCGCCCCTTTGCCAATAATTTTTTTGTAATTTGAGGTAGCAGAATAAAATGGTTTCCCCTCCTTCCTA
TGGATGTACTATGTTATTATGACAGAATTATAGGATATAGTAGCAAACAT
page-top