Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig52
Contig Information
Length 590 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11m11    rwhrd11m11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0535700 [Oryza sativa (japonica cultivar-group)] >gi|47900417|gb|AAT39211.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579709|dbj|BAF18072.1| Os05g0535700 [Oryza sativa (japonica cultivar-group)] >gi|215692606|dbj|BAG88026.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692940|dbj|BAG88360.1| unnamed protein product [Oryza sativa Japonica Group]
Score 225
Evalue 4.18953e-17
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig52
TCGCAGTCGGCGCAAGCAGAGAGCGGCGGAAGGAAGGAAGGGGAACCAAGGAGCGCAAGCAAGAGGCGGCGAGGCGGAGGAGGATGGGGTTCATGCTGCG
GGTGAGGCTGGCCTCCTTCTTCGCGGGCGCGGCCGCCGCGGCGGCGGGCGGCGGCTACTTCCTCTACAAGGACTACAAGCTCGCCCACGACTCCACGGCC
CTCCAGGTGAAAGGTCTGCATGACCACGTGGACGCCCGTTACAAGGCTCTCGACAAGCGGCTTGCAGCTTTGGAGGCCCAGAAAAGCGTCGACTCCTCTC
CGGCTGTGGACGCGCCATCGGGCTAGTCGTCCGTCTGTCCATCACGAGGCTTGACAAGTGGATGATTCTAAGTCTGTTTACTTTAACATGCGCGCGCTAT
CTGCTTCTCCTTTGAAGGCAAGGGGCCTGTGACTGACAGCGAAATAATATAGCGAACGGTTTTTGTTTTGTTGTGTGGGCAAGAAGAAGCTCCTTTTGTT
GCTTGAGGGGATGCATCAGACCTTTGCACACCATTTTGCACTTGCTGTCGCTTATCCTGGGGATTCAACCCGAACCCTTTAAAAAAAAAA
page-top