Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig49
Contig Information
Length 852 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10n13    rwhrd10n13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immature spike ubiquitin-conjugating enzyme 2 [Triticum aestivum]
Score 801
Evalue 1.46073e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig49
ACGACACCACGCCACAAAGCGAGGGGCGGACCCGGAGCAAAAAAGACCACCAAAGGCAGGCGTCCTCCGTCCCTCTGTCCTCGCCGTCCCCAACCTCTCG
CTGCAAAAGGTTGCTTGTCATGGCATCAAAGCGCATCCTCAAGGAACTCAAGGACCTGCAGAAGGACCCGCCCACATCATGCAGTGCAGGTCCTGCTGGT
GAGGACATGTTTCATTGGCAAGCAACAATTATGGGACCCCCTGACAGTCCCTATGCCGGCGGTGTTTTCTTAGTGAACATTCATTTCCCTCCGGATTACC
CCTTCAAGCCACCAAAGGTATCTTTTAAGACAAAGGTCTTCCATCCTAATATCAACAGCAATGGAAGCATATGCCTTGATATTCTTAAGGAGCAGTGGAG
CCCTGCTTTGACGATCTCCAAGGTCTTGCTCTCTATCTGCTCCCTGCTGACCGATCCCAACCCGGATGATCCCCTTGTTCCTGAGATTGCCCACATGTAC
AAGACGGACCGGTCAAAGTACGAGACGACAGCCCGCAGCTGGACGCAGAAGTACGCCATGGGTTGAAGAAGACCTGCATCGTGGACAACTGAAATGTCGC
TTCAAGAAAAATATTTATGGGCCATTGTTTCTTCGATTTGTTGCTGGTTGTGTGTAATCCGATCCTCAAGGATTGTAAATTGCATTCGGCGTCGGCCCTA
TCATCAATTGCCACTAGTATCGGCAGACATGCATGCCTATCAGCCTATTCACCTATGCTTGTTGGGTTAACCTTCATCGGTGTTGGTGTTATTTGGTAAA
TGTTCATTAAAACATGTTTGCTTCATGACCTTGTCCAGATTTATCTTCTTTG
page-top