Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig48
Contig Information
Length 743 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1i21    rwhrd1i21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_118632 [Branchiostoma floridae] >gi|210127287|gb|EEA74970.1| hypothetical protein BRAFLDRAFT_118632 [Branchiostoma floridae]
Score 78
Evalue 7.82837
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig48
ACCCGCGCCGCCGCACACGTCGTCGATCTCGTGCTCCGGAGCCGTCCCGCGCCGCGTCCAAGAGCCTCACCGTCGACGTCTCCTTCGCCTGGGTACTCCG
AATCGAGCAGGGACGCATCGCATCATCGCCTTGTTCGCCGTCTTCTCTGCCACAGTCGCCACTGCCTCCGCGTCGATTCGCCCGACCACGACCTCCCCCG
GCTTCCCCAAGACTGCCTCGACCACCACTACCCCGTGGCGGCTGCCGATGCCGCTGTGAGCGACTACGTCACCGACGACCCCTCCTTCTTGTCTGAGCAA
CCAGATGCTGGAGCCCAGGAGCCAGACGCCATCGTCGACGACGACTCCTACTACACCGGAGGTGCCTACTACTACGTGGAGGCCGCCGCCGACGACCAGG
AGTAGTTTAGGAAGATCCCAGGCAGGAGGCCTGTGCCTCTTTCGATCTGTATCCCAGTTTGTGCTAGCCATCTTATGGCAACTTGTTTAACTTATGTATA
TACTCAGATATTGTTGCTTCCGCTGACTCGTCTATGATTGAGCACTTGTATTCGAGCCCTCGATGCCCCTGGCTTGTATTATGATGATTGTATGACTTAT
TTTATTTTAGAGTTGTGTTGTGATATCTTCCCGTGAGTCCCTGATCTTGATCGTACACGTTTAACGTGTATGATTAGTGTACGATTGAATCGGGGCGTCA
CATTATCATTGATTAATAAAGATAGACTTCTTCAAAAAAAAAA
page-top