Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig47
Contig Information
Length 1183 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1i13    rwhrd1i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ALMT1-1135.1 [Secale cereale]
Score 1149
Evalue 9.40895e-175
Total Hit Count 144
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig47
GTCGTCGTCGTCATGGAGTACACCGTCGGTGCCACGCTGAGTAAAGGCTTGAACAGAGCCTTGGCGACGTTGGTGGCTGGCTGCATCGCCGTCGGAGCTC
ATCAGTTAGCTGAATTAGCTGAACGCTGTGGTGATCAGGGAGAGCCCATAGTGCTCACCGTGCTCGTCTTCTTCGTAGCGTCAGCGGCGACGTTCTTGCG
CTTCATCCCGGAGATCAAGGCCAAGTACGACTACGGCGTGACCATCTTCATACTGACCTTCGGTCTGGTGGCCGTGTCGAGCTACAGAGTGGAGGAGCTC
ATCCAGCTCGCGCACCAGCGGTTCTACACCATAGCCGTCGGCGTCTTCATCTGCCTCTGCACCACCGTCTTCCTCTTCCCCGTCTGGGCCGGAGAGGACG
TCCACAAGCTCGCCTCCGGCAACCTCGACAAACTCGCTCAGTTCATTGAAGGAATGGAATTCAACTGCTTTGGCGAAAACAGTGTTGCAAATAATTTTGG
GGGAAAGGATTCCCCCCAAATGCACAAGAGCGTCCTTAATTCGAAGGCCACTGAGGACTCTTTGTGCACCTTTGCCAAATGGGAGCCTCGTCATGGCCAG
TTCAGATTTCGACACCCATGGAGCCAATACCAGAAGCTGGGAACTCTTTGTCGCCAATGTGCGTCTTCTATGGAGGCTCTTGCTTCATATGTCATCACAA
CCTCAAAAACCCAGTGGCCCTGCTGCAGCCAACCCTGAGCTATCATGTAAGGTTCGAAAAACATGTGGCGAAATGAGCTTGCATTCCTCCAAGGTGCTTA
GGGATCTCGCAATGGCAACTCGAACAATGACTGTGCCGTCTCCAGTGAATATCACCATGGCTACAGCCGTGAAAGCAGCGGAAAGCCTCAGAAGCGAGCT
TGCAGAGAACACGGCTCTGTTGCAAGTGATGCATGTGGCCGTCACCGCAACACTTCTTGCGGACTTGGTTGATAGGGTGAAGGAAATCGCGGAATGTGTT
GATGTCCTAGCAAGACTGGCGCACTTTAAGAACCCCGAGGACACAAAAAATGTCGTTGTCAGTACCGTGAGTCGAGGGATAGACGAACCTTTGCCTGACG
TGGTTATTTTGTAAATCTTCAAAACATTGGTAGACTATATGGTGAAGAACATGGTAGTACTATAGTAGTACTATGTATCAATA
page-top