Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig43
Contig Information
Length 671 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11l19    rwhrd11l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit succinate dehydrogenase [Triticum aestivum]
Score 777
Evalue 5.57245e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig43
GTTCGTCGTCAAGGACCTCGTCGTCGACATGACCAACTTCTACAACCAGTACAAGAGCGTGGAGCCGTGGCTCAAGCGCAAGGACCCGCCGTCGGCCGGT
GGGAAGGAGATCTACCAGTCCAAGGCCGACCGCGCCAAGCTTGATGGCATGTACGAGTGCATCCTCTGCGCCTGCTGCTCCACATCCTGCCCGTCCTACT
GGTGGAACCCAGAGGAGTATCTCGGCCCTGCCGCACTGCTCCATGCCAACAGGTGGATCCAAGACAGCCGTGATGAGTTCACAAAGGAGCGCCTCGACTC
CATCAACGACGAGTTCAAGCTGTACCGCTGCCACACCATCAAGAACTGCACGCATGCCTGCCCCAAGGGGCTCAACCCGGCGAAGCAGATCGACACAATA
AAGAAGCTGCAGCTCGGAGCCTGAGTGAGGTCTACTACCCCGTGGAGATGTCGAAAGTTGTAATCAGCTGTCATTTGGTTTGTTTTGGCTCCGTGGTGAC
GAATAATGGGTGGAAACGCAGGATATTCCCCGCTTGACGATTCCGTGTAGGGAGTGAATAATTGCTACCAGATTTTATTCTTTTCGTGCTGTATTCTAGT
TTGGTGGTTCATCGTTGATCATCTTTTGATGCATGTCCATGCTTCAAGTAATTCATAAACTTTTGAGTAAA
page-top