Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig41
Contig Information
Length 1282 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11k23    rwhrd11k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0395000 [Oryza sativa (japonica cultivar-group)] >gi|20503052|gb|AAM22740.1|AC092388_24 putative serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)] >gi|21263201|gb|AAM44878.1|AC122144_1 Putative serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)] >gi|31431881|gb|AAP53593.1| serine/threonine-protein kinase NAK, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639134|dbj|BAF26439.1| Os10g0395000 [Oryza sativa (japonica cultivar-group)] >gi|125574683|gb|EAZ15967.1| hypothetical protein OsJ_030176 [Oryza sativa (japonica cultivar-group)]
Score 1446
Evalue 4.42023e-158
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig41
TCGGCCTCGGCTGCTTCAGCTCCCACCGCGACCACGCCAGCGACGACTCCCGACCGGCCAGGCCGGCCCCGCTGCCTAACGACGACGGCCTTAAGACAGG
CAGCGGCGTGACGCCGTCGCCGGACGATCTGTCCTTGTCGCTTGCGGGGTCCGGCGTGGAGGCGTTCACGGTGGACGAGCTCCGGACGGCGACGCGGGAT
TTCTCGACCAGCAACTTCGTCGGCGAGGGCGGGTTCGGGCCGGTTTACAAGGGCTATGTCGACGAGCAGCTCAAGCCCGGCGTGCGCGCGCAGGCAGTCG
CCGTCAAGCTGCTCGACCTCGAGGGCTCGCAAGGACACAAAGAGTGGCTGGGAACTTTCTGGGTATGGATTGTGCTCTCGCTGCATGGTGGGCGCCCGCC
AGAAAACCCTGCGTGTCTTCATCTTTGGGGCAGCGACAACAGGTGCTTCTATTATTTGGTTGAAGTCGTTCTTCTCGGACAACTGAGGCATGCACACCTG
GTCAAGCTGATCGGCTACTGCTGCGAGGATGAGCACAGGCTCCTCGTTTACGAGTTCGTGGCGAGAGGCAGCCTAGAGAAGCATCTCTACAAGAGGTACA
CGGCATCGTTGTCATGGTCAACAAGGTTGAAGATTGCCATTGGAGCTGCCAAAGGTTTGGCCTTTCTCCATGACGCTGCCAAGCCCATCATCTATCGTGA
CTTCAAGACCTCCAACATACTACTCGACTCGGATTACCAAGCGAAGCTTTCTGATTTTGGCCTAGCGAAGGATGGGCCCGACGGAGACGAGACACATGTC
TCCACTCGAGTCATGGGCACACAGGGCTATGCTGCACCAGAGTATATCATGACTGGTCATCTAACAACGAAGAGCGATGTGTATAGTTTTGGTGTGGTGC
TACTGGAGCTTTTGACGGGGCGAAAGGTGGTGGACAAAAACCGGCCGTCACGGGAACAGAGCCTCATCGAGTGGGCGCGGCCATACTTTCTCCATGACTC
GCCCCGTCGGCTAGACCGTGCCATAGACCGAAACCTGGACGGGCAGTACTCGGCTCTGGCCGCCCAGAAGGCTGCAACCATGGCATATCGATGCCTGAGC
GTCAGCCCAAAGTCTCGGCCTCAGATGTCCGCCGTCGTTGAGGCCCTTGAGCCGTTGCTTGCCATGGACGATGGCGTCGTAGAACCGTTCGTGTACACCG
CACCATCGGAGAACAAATGACTACATCTGATGATGTCGTGTAATAGCATGCATACTATTCTTTACAAAAAAATAATCAATAT
page-top