Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig40
Contig Information
Length 937 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1h09    rwhrd1h09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38782 [Oryza sativa Indica Group]
Score 297
Evalue 4.77506e-25
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig40
GGATGATTCTGTGATGAAGACTGCAATAGGTGTCTTGGGAGATCTGGCAGACACATTGGGTGTCAATGCTGGTCCTTTGATCAATCAATCCACCTCAAGC
AAGCAATTTTTGGACGAGTGCTTATCATCTGATGATCCTTTGGTCAAAGAATCAGCTGACTGGGCAAGGATTGCAATCAGCCGTGCGGTTTCGGGTTGAC
GTCACATTTGTCTTGAGTCTGCACATGCATCCATCCACGAGTCAGTCCAGGTCTTCGGTTGCATCATGTCTAGACCTGCTCTTTGGAGAAGTCCAACGTC
CTCAAAGCAGAGTCGGAGGGTCCTCACTAACTCATGCATCAGTACATGTGTCAACCCAGCCTTTTTCACATATGCGGAAAAGAGGGTTAAGTTGGCCACC
TGCTAACTTTTCTAAAAAAAAGGAATCCAGGAGCTTCTATTGTCGCCTGCGACACCGATGGTCCCTCGGTGTGGCATCCGCGCTTATGGTCGGGGCGCTC
TTGCTTTCCCTTGCATCCATTGCATGCATCGAACTTTGGTCATATGGTCACTCACTAAAAGGCCCGGTTGCTTATTCATCCATTATGCATAAGGGGCTCG
CGTGCATTGTCACAGGATTTTTGTACTGCTCAGGGTGTACAACTTCACTATGTGGGGGCATGTTCCTCCTAAGCTGGCATTTTTTTTCTTTCGCATTTGC
ATTGTCTTGCATTCATCCCAGACGGTTTTGTAAGGGTTCTTTTGGTCAAAAACTGAGATCCCAGACGGTTGTGTCGGTTTATTTCAAGGTGTTGTCGGAG
CAGTGCGTGATTGCGCTCTTTTTTTTGGGTCATCTATGCTGCTGTTCCATTTCAGCTTCTTTGAAGCTTGTGCTGGCTGGTGGAAACGAACAATTATAGG
TCTTGGAGTGGTTTTGTTTGGGGGGCAGTGTCGAGTG
page-top