Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig37
Contig Information
Length 857 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1g09    whrd15c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0628800 [Oryza sativa (japonica cultivar-group)] >gi|108709940|gb|ABF97735.1| H1flk, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549179|dbj|BAF12622.1| Os03g0628800 [Oryza sativa (japonica cultivar-group)] >gi|215712242|dbj|BAG94369.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218193358|gb|EEC75785.1| hypothetical protein OsI_12704 [Oryza sativa Indica Group]
Score 1007
Evalue 1.91981e-107
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig37
AGCTGAGGACGTGATTCTGGAAGCTAACAGGAAGCAACGGTTCGAGCGGATCACGAAGGACCTCAAGGTGACGCGTGTGTTCTCCACACTGGTGCATGAG
ATGAAGGCCATCGGCACGGTGACGGGGATGAATGGCGAGGAGGAGGCGCACTGCACCGACGTTATGGCCCCGGTGGCGCACAGCGACCGGTCCCCGGTGC
TGCTGCTGATGGGCGGCGGCATGGGCGCCGGCAAGAGCACCGTGCTCAAGGAGATACTTCAAGAGCCGTTTTGGATAGAGGCGGGGAAGAACGCTTTGGT
GGTTGAGGCGGACGCTTTCAAGGAGACAGACGTGATCTACCGCGCCATCAGCTCCATGGGCCACCACAACGACATGCTTCAGACGGCAGAGCTGGTGCAC
AAGTCGTCGACGGACGCGGCGTCGTCGCTGCTGGTGACGGCGCTGAACGAGGGGCGCGACGTGATCCTGGACGGCACGCTCTCCTGGGAGCCCTTCGTGG
AGCAGACCATCGCCATGGCCCGGGCCGTGCACTCCCAGCGCCACCGCATGGGCGTGGGCTACAAGGTGGACGAGGACGGCACCATCACCGAGAACTACTG
GGAGCCCGTCCCCAACGACCAGGACTTTGTCGCCGCCAACAGGGACCGGAAACCGTACCGGATCGAGGTCGTCGGCGTCGTCTGCGACGCCTACCTCGCC
GTCGCCAGAGGGATCANGAGAGCGATCATGACGGGGAGGGCGGTGAGGGTGAACTCNCANCTCACNTCNCACAANANATTCNCGGCGGCGTTCCANAANT
ACTGCCANCTTGTGGACNGGGCCAANCTCTACANCTCCAACTCCTTGGGCTCTCCAC
page-top