Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig35
Contig Information
Length 588 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11k18    rwhrd11k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0536300 [Oryza sativa (japonica cultivar-group)] >gi|113624332|dbj|BAF24277.1| Os08g0536300 [Oryza sativa (japonica cultivar-group)]
Score 354
Evalue 4.54283e-32
Total Hit Count 292
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig35
CAACAAGCGAATGAAGGTAAGCTCATGCACCTCGACGATGGATGGCCCAACAACCTCCGGGAGCCATGTGCCTGCTTCTGGGACCTTGGGGAGCTCTTCC
CATGACAGAGGAGCAGCTCCCACTAGGGAGATCTCCTTTGGCGATCAAAGGATCGTCCCGACTGGAGCTGAGAAGCCTGCCGCAAGGATCGACAGCGAGA
CGCTCGCGCTAAACAGGGATAGCGCGATGCAGCGGTACAAAGAGAAGAGGAAGAATCGCAGGTACGAGAAGCACATCCGGTATGAGTCCCGGAAGCTGAG
GGCGGATACCCGTAAGCGGGTGAAAGGCCGTTTTGTCAAGTCGAATGAAGCGCTCAGTGCCGGCAGCAATGGCGGATGAGCTAGCCTTCTTCCTTGCTCG
CAGCACGGAGATGGCATCCTGCGCTGCACCTAAGCATGATGCCGTGCATTGCTCAGCTATTTTTTGTGTCTCATCATTTTCAGCATCGTGATCCAGAGGA
TCATTTCACGGTGTGTTTCTTTTGTAAGAGACCTCCCCTTTTCTCCTCAGAACACATAAATAGCCAGCTTAATTTTACAAAAAAAAAA
page-top