Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig32
Contig Information
Length 291 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1e15    rwhrd1e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit germin-like protein 4d [Hordeum vulgare subsp. vulgare]
Score 180
Evalue 4.0748e-12
Total Hit Count 152
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig32
GTCAGACCCACCAATATCCGATGATGTTCTTGCCAAGGCGTTTCAGGTGGAAAAGAATACAATAGACTGGCTCCAGGCTCAGTTCTGGGAGAACAACCAC
AACTAAGTGAAAGGTTGGCTGATTACACAGAAGACCAGTGTGCAAATTAAGGACATGTTTGAGTTTCTAGATATGCATCCTAATCTATAAAATAAATGGA
GCATATGCCATTTCATTCCATGTCCTGTAATGAGTGAATGTATTTCTACCTTCAGAATAATTGACAATATCGTTCTTTATCAAAAAAAAAA
page-top