Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig31
Contig Information
Length 678 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11j03    whrd16c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0594100 [Oryza sativa (japonica cultivar-group)] >gi|50725401|dbj|BAD32875.1| putative 3-hydroxyisobutyryl-coenzyme A hydrolase [Oryza sativa Japonica Group] >gi|50725651|dbj|BAD33117.1| putative 3-hydroxyisobutyryl-coenzyme A hydrolase [Oryza sativa Japonica Group] >gi|113596018|dbj|BAF19892.1| Os06g0594100 [Oryza sativa (japonica cultivar-group)] >gi|215704240|dbj|BAG93080.1| unnamed protein product [Oryza sativa Japonica Group]
Score 893
Evalue 2.03641e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig31
CTCTCTCGCATCCCGATCTCCCCTGCTGCTTTCTTCTCCTCCTCATCCCAAACCCTAGCCCCCCTCCGCCTCGGCCACCGCTTCGTCGCCATGGCCGCCG
CCGCCGCGGAGGAGTTCGTGAAGGGTCGCGTCTTCCCCAACGGCGTCGCCGTCATCACCCTCGACCGCCCCAAGGCCCTCAACGCCATGAACCTCGAAAT
GGACCTTAGGTACAAGGCATTTCTTGATGACTGGGAAACAAATCCAAATGTGAAGTGCATTCTTGTGGAAAGCAGTTCTCCCCGCGCCTTCTCAGCTGGG
ATGGATATTAAGGGTGTTGCATCGGAAATTCAAAAGGACAAGAGCACATCATTTGTGCAAAAGGTCTTCACAGCTGAGTACTCTTTGATTTGCAAGATAC
ATGAGTATGCAAAACCTTATATATGCTTGATGGATGGTGTGACCATGGGGTTTGGAATTGGATTGTCTGGACATGGCCGCTACCGCGTTATTACCGAGAG
AACACTCCTGGCCATGCCAGAAAATGGTATTGGCTTGTTCCCAGATGTTGGCTTTGCTTACATCGGTGCAAAAGCGCCAGGAGGGGGCGCAGTCGGAGCT
TACCTTGGGATGACAGGAAAAAGAATATCTTCACCTGCTGATGCTCTGTTCATAGGTCTCGGAACCCATTATGTACCT
page-top