Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig30
Contig Information
Length 1178 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1e08    rwhrd1e08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit BRI1-KD interacting protein 103 [Oryza sativa Japonica Group] >gi|50252883|dbj|BAD29114.1| BRI1-KD interacting protein 103 [Oryza sativa Japonica Group]
Score 605
Evalue 1.30082e-60
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig30
AGGTGGAAGAATTGCAAGAGCTCCACAAGACTGAGGTTGAGAAGTTCATGACACAATGGTGCAGCAGCAAGACCTTTAGAGAGGACTATGAGAAGAGGAT
CCTCACTTCCCTCAATGGACGGCAGCTGACCCGAGATGGCCGGATGAGGAATCCTGATGAGAAGCCCATATTTATCGAAACACAGCAGCCAGCAGCACCT
GTGCAACAGGAGCCTATCCCATCAAAAGCGCCTTTGAAACAAGCAAAGGAAGCTGCTGCTCCTCAAGTCGTCGCTCCCAAAGAAGAGCCCCTTGCAAAAG
CATCTGCCAAGTCAGCTAAGGTAAAAGCTGCTGTGGATGCTGATGATGATGCCTATGAGGCTGAGCCTCCAAAGGAGAAGCCCAAGCCTAAAGAGGTTGA
TGTAGCAAAGTTGAAAGAGATCAAGAGACAGGAGGAAATCGAGAAGAATAGACTTGCTTTGGAAAGGAAGAAGAAGCAGGCTGAGAAGCAAGCGGCGAAG
GCTGCAGCCCGAGCACAAAAGGAAGCTGAGAAGAAGCTTAAGAAAGAGGAGAAGAAAACCAAGAAGAAAACTGAGGCAGATACGGACGAGCCAACTGACT
CAGACACCAAGTCTGATGAAGCAGCAGAAACCCAAGCAGAGGATGAGTTCACTCCAGTTTCTGTGGTAAACAAAGAACAGAAGCAGAACACACGGACCAG
GAATGTAGTCACCAAGACCAAGGCCCCGCTGCCAAAGGCGATCCTGAAGAGGAAGAAAGCCCAGTCGTACCGGTCATGGGCCACCCCAGCCGTGATGATA
TCCGCCGTCACCGTGCTCGTCGCCCTGCTTGCGGCGCTGGGCTACTACCAGTACTACCGCCCGGCGAGCACCAGCAACTGATGGAAGGAAAAGGAGGCCT
GTGCACCCGCCGCCCTCGAGTATGAATCTTACTAGACCAATTTTGCAGGTGAGAGCAACAGAGTGCGTGGTCTGCCTAGACCTGAATGAACTGAAAAGTC
TGGAGAAGCTATTCGTTTCTGTTCTGTTTGTTGGGTGGAGTCGGATAAAAAGTTGCAGTTAATTTTGGTTGGCACAGTTAATTTCGTCCGGGACTTGAGA
GTCTATATACTGCCAGTGAACTCAGTTGTACTTTAAAGTGGAGAATAGATTGCGATCTGAAATAAGTATGCCATGTAA
page-top