Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig26
Contig Information
Length 834 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10o02    rwhrd10o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ascorbate peroxidase [Hordeum vulgare]
Score 956
Evalue 1.50166e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig26
GGCGGCCCCTTCGGCACCATGAAGTGCCCCGCGGAGCTCGCGCACGGCGCCAACGCCGGCCTCGACATCGCCGTCAGGCTGCTCGAGCCCATCAAGGAGC
AGTTCCCCATCCTCTCCTACGCCGACTTCTACCAGCTCGCTGGAGTCGTCGCCGTCGAGGTCACCGGCGGGCCTGAGGTTCCCTTCCACCCGGGGAGACA
GGACAAGCCCGAGCCTCCTCCAGAAGGCCGTCTTCCTGATGCCACCCAAGGCTCTGACCACCTCAGGCAGGTGTTTTCCACTCAGATGGGTTTGAGTGAC
CAGGACATTGTTGCTCTTTCTGGTGGTCACACCCTGGGAAGATGCCACAAGGAGAGATCCGGCTTTGAGGGAGCATGGACCGCCAATCCTTTGATCTTCG
ACAACTCTTACTTCACTGAGCTCCTGAGTGGAGAGAAGGAAGGCCTTCTTCAGTTGCCGACCGACAAGACCCTCCTGACCGACCCGGCCTTCCGCCCACT
TGTGGACAAATATGCTGCGGATGAGGATGCGTTCTTTGCTGACTACGCTGAGGCACACCTCAAGCTCTCCGAATTGGGATTTGGCGAGGCGGGCTGCTGC
TGATTCAAGCTCGGCGCCTGAAGGTCGGTGGTAATGAAGAAGAAGAAGATCATGAAGAAGAAGAAGAGCAATAAGGATGTGTTGGCCTGCTGCGGCCATG
TCATGTGTTAATTTGTCTCGACTTGGATTAAATGGGTCGGTCGATGGGGTGTTGCATTGTTTTGCTTTGGACGCCTCGTGTCTTGTGATGGGCGTGCTTG
TAGTATGAACTGCTAAGTGTTATGTAGTCCTTCC
page-top