Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig24
Contig Information
Length 1107 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11j05    rwhrd11j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0635300 [Oryza sativa (japonica cultivar-group)] >gi|113565577|dbj|BAF15920.1| Os04g0635300 [Oryza sativa (japonica cultivar-group)]
Score 272
Evalue 4.90546e-22
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig24
CAGATTCTACACTCCACTACTGCCCAATCTTCAGGAACCTCAAAGTTTTGCAAAAGAAAGAAGAGAGAGATCATGGCGGGTGCGGCGAAGGCGTCATGGA
CGGTGGCGATGAGTGTGGGCGCGGTGGAGGCGCTCAAGGACCAGGCGGGGCTCTGCCGCTGGAACTATGCGCTCAAGTCCATCCACCGAGCTGCCAAGGC
CAAGGCCACCGTCCGCGGTGGCGTCTCGCAGGGCAGCAAGCAGCTTCAGGCCTCCGCGTCGGCCGTGGCGGAGAGGCGTCGAGCAGAGAAAGCAGAGGAG
GGGCTGAGGACGGCGATGTACCTCAGTTGCTGGGGTCCCAGTTAGTGGTAGCTAGCCAGAGGTGTTTCTGCAGTTCTGCTAGCTCTATCCCCCAGCAACA
ACCATGCCATGTGGCTTGGCTGGTTGATTCCCTCACGATTGTAAATATGTCTCACCATGATGATGATGATGATGATGATGAAATCTTTCCCCACTTTTGA
GTTCAAATTACCCTGATTCAGGAAAAGGTTTGAATTGCCCTTAAAACAGGCCTGTTTGCTTAGGATTCTTTTGGAAGACTATTGCTTCCAGTTGGTCACA
AGCTTTGCCTGTTGCTCTGTTCTGTTCGCTGTTTCGACAGGCAGAGCAAAAGCAGAGACCCAAAAAATTGATCCCGGTCCTTTTCCTATTTCGTAGGTTC
AGTTTCATAAACATACAAGGGATATGTTTCTACTAATCATGGGTCGACTTTCTTGTGTTGCGTGATTATTAACAAACAAGCGCTGAAACGAAGCGTGTGG
CACTGGAAACCATGTCCGGCTCTTCTGGTTTTCCCCTTTTCAACTCTCATACATGTGGTCTCACTGTCGCCTGTCCACAACATCAACGTGAGGTGATACT
GATAAGATTCTCCAATTAAGTTGGTGCAGAAACTTAACATATTTTGATACCGCACTGAAAAGGTGATTGTTCTTAAATAATTTTTTGGTACAGTTAGCAT
TTCTTGTATTTACATGTCACAAGTGGTTACTTTTAAAATTTGTAGGGCCAAAGATTTTTATTTCCGAAAGGAACTAAGGTCATATATATTAAGTATCACA
AGTCCTA
page-top