Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig23
Contig Information
Length 832 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1c05    rwhrd1c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast channel forming outer membrane protein [Zea mays]
Score 559
Evalue 1.61565e-55
Total Hit Count 139
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig23
ACTCTGCAGGTCAGGAGCCGCCGGAGGGAGGGAGGGAGCGATGGAGACCTCCCTGCGGCTGCGCGGCGCCGACAACACAACCGGGCAGCAGCTGGGCCTC
CGCATCCACGCCAAGCAGAAGCTGCCCCTCGCCTACAACGCACTCCTCCAGGCTCACGCGGAGATCGACACCGCCACCCGGAAGCCCAGCCTACTCGCCG
TCCTCGCAAGGCACTTCTTCCCACAGCTGTCGGCCAATGTTGGAGCCGGAGTCCAGCTGGAGAGGGGCAACATCTTCAGGTACACCCTCCGGGGGAAGAA
AGCCGTCTCCTTCACCGACGACGGCCTCCTCGGCCTCAACATCAAGGGCCGCCTCCTCGCCGACAAGAACTTCAAGCCGAGGAGGAAGAGCGGCGCCATC
GAGCTCGCCTGGACCATACTCGACTTCAGAAAGGGCCAGGACGTCAGGATGAAGGCCGGCTACGAGCTATACCGCAAGATGCCTTATTTCCAGCTGAGGG
AGAACAACTGGACGCTTAATGGTTACATGGATGGAAAATGGGATGTCAGATTCGATATGTGATCGACCAGGAACCCGTTTGTGGAGGAGGGACTTCTCTG
GCGATCAGTTAGCGCTCTAGTTGTGTTGCCCCTCCTTTAGAGGCCACCATTTCATTTCATTGTATTGCTCTGGAAGGATGCCATTCACCAGCAAGCACCA
GTTTTATGGAGAAAAGTCGTATGTAGAAGTAGGAACCCTAGACATTTCATTGATGTGATTGAGTCTGGAAAATTCAGGATTCAGTTGTGTCTTCATGTAG
CGTTGATGAGATTATTGGTTGGATGAAGGCAT
page-top