Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig22
Contig Information
Length 796 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1b16    rwhrd2p16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calnexin precursor [Zea mays]
Score 327
Evalue 1.98422e-41
Total Hit Count 112
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig22
TATGGGAACGGAGGGAGTACCTGATTTAGCACAGCACACAAACAACCGAAACACAAGCCTTCATGTTTCATCTGATATAAAACAAAAGAAATAAAAAACA
AAAGGAAAGGAAAAAAAGACATCTCTTCTAGCTGATTCAGGACAGCACACAAACAACCGAACAACACGAGCTTCGCCGGCTCGTAATGTCAAGCGACTTA
AAACTAGAGGTTGCTACTAGCAGCAGAGGGTTCGATTATACACTCGAGGCGTTCTCAAAAAGGCTATAACCGAGTCCTTCAAAATGTGAAGGCACCAAGA
GTTAGTTTATGCGTCTCTTCGCGACCTTCGGCGCGGCGCATCCTTGTCATCCTCCATGTCGCCGCTGCTTCCAGCGGCGGCATCAGGTACGACAGCACTG
GGCTTCTTGGTCTCAGCAGCGGGCTTCACAGGTGCCACTGGCTTCTTGCCACCAAACAGGGCTCTGAAGAGTACAGTCACAATGACGACGATGACAGACG
CCAAAATCGAAATTGTAATGTTTGGCTGTGTCTCTCCCTTCTCAATCACATCAATGATCTTGGTCTTGTATGGTTCCAAGAACGGGATGTCTGCAACTTT
GTACAAAATGTCAAAGATCTTCTTCTGGAATTCAGAAAGGCCTTCTGATGCACCTGCTGCAGCCTCCTCAGCCTTCTGCTTTTCCTTCTCAACATCAAAC
TTGGGGCTTCCATGTCTTCTCCCGGACAGAGGTGGCTACCTTCTCATTATCGGCAATAAGAATGTTGTCAAATAGGATGCCATCCTGCATTGTCCA
page-top