Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig21
Contig Information
Length 581 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd1b04    rwhrd1b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0529800 [Oryza sativa (japonica cultivar-group)] >gi|21742093|emb|CAD41204.1| OSJNBa0074L08.15 [Oryza sativa (japonica cultivar-group)] >gi|32492276|emb|CAE03857.1| OSJNBa0081C01.3 [Oryza sativa (japonica cultivar-group)] >gi|113564954|dbj|BAF15297.1| Os04g0529800 [Oryza sativa (japonica cultivar-group)] >gi|116312023|emb|CAJ86379.1| OSIGBa0155K17.6 [Oryza sativa (indica cultivar-group)] >gi|125549113|gb|EAY94935.1| hypothetical protein OsI_16741 [Oryza sativa Indica Group] >gi|125591070|gb|EAZ31420.1| hypothetical protein OsJ_014903 [Oryza sativa (japonica cultivar-group)] >gi|215697555|dbj|BAG91549.1| unnamed protein product [Oryza sativa Japonica Group]
Score 378
Evalue 7.26451e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig21
GAGATATTTCCTATAAGATTGCGAGCTCAGGCATCAGCACTTGGTCAAGTAGGTGGCAGAGTGGGCAGTGGTTTGGTTTCCATGTCATTCCTCTCCATGG
CCCGCGCTATATCCGTGGGGGGAATGTTCTTCGTCTTTGCAGCAATCTCGACCGTCTCCGTTGTGTTTGTGTACTTCTGTGTGCCAGAAACTAAAGGGAA
AACTCTGGAGCAGATTGAGATAATGTTTGAAGGTGGGAAGGAATGGAAAGGAGGTGGCGAGGTCGAGCTTGAAGATACACAGCATTTGATACAGGGTGAC
AAGAAATCTTTCTCTCTAGGCTGATATAATCATCAAAGCAACAAGAAGCTTCATGTCAGCGCTGAAACAGCCTCGTCCTGCTTCCGACATCAGGTTGAAA
GCTCAACAGGACTTTGCTGCGCATAGGTTGTGACATAGATGGTGTATTGTGTTTTTAGTCTAAAGTACTCCATTATACAACCATATCACAAACATCACGT
AGGACACAATGCTGTTGTATCTGGTGGTGTCTTCCACCTATAAAATCAATATAGTCGAAGAATTCATTTGTAAAAAAAAAA
page-top