Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig20
Contig Information
Length 760 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10p24    rwhrd10p24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit blue copper-binding protein [Dasypyrum villosum]
Score 586
Evalue 1.00923e-58
Total Hit Count 459
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig20
ATCCTCTGCTTTGCATTCCTCCTTCCAGTTCCAACCGCAATCAATGGCCGCCATGAAGATCACTCTCCTTGCCGTGGCCACAATCTCGGCAGTCTTACTG
GGCACCGCGTCGGCGGCGACCTACGGTGTTGGCGAGCCGGGCGGTTCGTGGACCCTCAACACCGACTACAGCAACTGGGTGTCCAACAAGAAGTTCCACC
CGGGTGATGAGATCATCTTCAAGTACTCCCCCGCGGCGCACGATGTGGTCGAGGTCAGCAAGGCTGGCTACGACTCCTGCAGCACCGCCAGCGCCATCAA
CACCTTCAAGTCCGGCAACGACGTCGTCCCCCTCAACGCCACCGGCACCCGCTACTTCATCTGCGGCATCACTGGCCACTGCAGCCCCACCGCCGCCGCC
AGCATGAAGGTCGTGATCGACGTCGTCCCGAGTTCCTCCTCACCGTCGTCACCCATGCCGGCTGCCGGTCCGGACGCGAGCAACCCGCCGCCACCCTCCT
CTACCGCATCCTCTGTCGGGGCCACAGCAGGATTTGGCCTTGTCGTCCTACTGGTCGCCAGTCTCATGGTTTAAAATGCATATTTCAGCCAGCTGCATGC
CGCACGCACATATGAGCTTACATATTGTTTGACTGGTTATTACTGGGGAATACATACATGTATTATTGCTTAGAGCGAAGATGTGAGAACTACTTTGTAA
GTTTGTATCTCTCACGTTTGTATGTAATCTACTGGCCTTTAGGCATTTCATATGATTTTG
page-top