Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig18
Contig Information
Length 531 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11i07    rwhrd11i07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_011832 [Oryza sativa (japonica cultivar-group)]
Score 198
Evalue 4.20198e-14
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig18
GAGCTCCGAAGAACAGATGATTCAGCTCCTACAGCTCGCTATAGACTGCGTTGCCCAGGTCCCAGACGCCCGTCCGACCATGTCCCATGTCGTCATGCGG
ATCGAGGAGATCAAGATGTCAGGTGGAAGCGCCGAAGAAGCTGATCAACAACAGAGCGCCCTGAACCAGGGCGATGAGATGGCCGAGGGCCCCTCCTCGC
CGTGATCTCAAATGGCCCAAGAGAAAGGAGCCGGCTGTGCTCGTCGCTGCAGCCCACATTCATTCCGTTCATAGACCTGACGAATGCTGTCTATCTTCTT
CTTCGACGGCGGAGCCGGCTGTTTTCTCATCTCTTCCTTTTAGCGAACATCGGATTCGTTGTCGTCGTCGTCGTCGTCTTGGTGTTGTTGACTGACTGTG
TCTGTTGTGTGGTGGGTGATTGCGTGGTGGTGGTGTTTAGGGATGGAATGCATGCATGCCCGACTGTGCGATTGCTTGATTCGTCTAGCTATTGTTCTAG
CTGATTAGGTTGGTTCTTTAGCTGTCCCCAT
page-top