Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig17
Contig Information
Length 506 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11h17    rwhrd11h17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin 93 [Zea mays] >gi|195621944|gb|ACG32802.1| early nodulin 93 [Zea mays]
Score 365
Evalue 2.68479e-34
Total Hit Count 116
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig17
AGGGCCATGGCCGCCAGGAACTTCTTCGTCCGATCCCCCAAGGAAGGAGGAATCCAGCGCCGCCATCCGAGAGGCTGTCCTGTTGGGAGGGAAGAACGCC
GCCATTGCTGGCACCGTGGTCGCGGTTCCCACGTTCGTTGCCTGCCGCGTCCTTCCTTGGGCTAAGCATAATCTGAACTACACCGCGCAAGCGCTCATCA
TATCGACAGCCTGTGTCGCCGGCTTCTTCATCACCGCGGATAAAACCATTCTGCGAAACGCAAGGCAAAACACCATCGGGAGGACCTGATCCAGAACTGT
ACAGAATCGCAGGCCCTCTGTTCCATCCATGATCCATTGATGGTGCTGCATGAGGAGACGTCGAATTTCAGTTTCAGTTTTTCTGTACCTTGCAGTGTAA
AGAAGACTAATGAGAGTTGCTGTTTTCTAGGGCCAGTGGATCCCGTTTGCTCCCAGTTGAAAGTGGAATAAAAGATGGAATGTTTTCCTTGTGCCCAAAA
AAAAAA
page-top