Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig16
Contig Information
Length 642 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10o15    rwhrd10o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein nfa9000 [Nocardia farcinica IFM 10152] >gi|54014375|dbj|BAD55745.1| hypothetical protein [Nocardia farcinica IFM 10152]
Score 78
Evalue 5.72199
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig16
GCGGCGGAGAGCAGTGCCGGATCCGAAACCTGGACGATGGACGGAGTTCGAGCCCCGCCCGTCCCGCTCGCCGTGGCGGTCCCTCCTCGTCTCCACCCCT
CTCCTCGACTCGGCGGGACGAGGGGAGCAGGGGCAGCAGCCAGCCATGCCTCGTCCGTCTCGCATGGTGGCCCAAATACGGCTTCCTCGTGCTCTGTCGG
CGCCCGTCGACCTCGATCCAGCTGGGGCAGGAGGAGCTCGAGCCGAGGAGCGTGGCCTCGATCCGGAATCGACGAAAGAAGGGGAGCAGCAGCCATCACG
CCTCGTCACAAATCATTCCCCGTCTCTTCTGTTTGCACCTCCCCCCAAGCGGCCACAGGCTGCCGCCGGGGACACCTCTGCATCATCGTCGACGGAATGA
AGGGAGCAACGGCCACAACCGCCTGCTGCAGCGGTGCTGAGCGGCTGCGGACCTACAGCGAAACGGTGCTGGATCCATATGTACTCCTCTGCCAGTCTTC
TTCACGCCGCAATTTACTCCTCCTTGCTGCACCTGATGCTGGAGCCCAGAAGCCAGATGCCACCGTCGATGACGACTCCTACTACACTGGAGGTGCCTAC
TACTACGTGCAGGCCGCTGACGACGACCAGGAGTAGTTTAGG
page-top