Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig15
Contig Information
Length 760 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11i03    rwhrd11i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0149200 [Oryza sativa (japonica cultivar-group)] >gi|27261473|gb|AAN87739.1| Unknown protein [Oryza sativa (japonica cultivar-group)] >gi|108706200|gb|ABF93995.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113547442|dbj|BAF10885.1| Os03g0149200 [Oryza sativa (japonica cultivar-group)] >gi|215769423|dbj|BAH01652.1| unnamed protein product [Oryza sativa Japonica Group]
Score 425
Evalue 4.70986e-40
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig15
GGTCGCGCCGCGGCTCCTACCCCGCCTCCCCCACCGTATCCCGCCGGTCGCTCGCCTCGCCCCGCCGCCGCCGCCGCAGGTTGACATGGGGTTCGTGTCC
TTCGCCGGGAGGGTCCTCTTCGCCTCCGTCTTCCTCCTCTCCGCCTACCAGGAGTTCACTGAATTTGGAACTGATGGCGGGCCAGCTGCAAAGAATCTTG
CGCCTAAGTTTAACAGTTTCACCAAAAATATTTCTGTACACCTCGGAGTTGTGGTGCCTCATGTAGAGTTGAAGCATGTGGTTGCTGCTACCATTGGTCT
GAAGGGTCTGGGTGGTCTCCTGTTTATCGTCAGCAGTTCATTTGGTGCTTATCTCCTGGCTCTCTACCTTGCTTTCATCACGCCCGTCGTCTATGACTTC
TACAACTACGACATGGAGAAGGCTGAATTTGTGCAGATCTTCATGAAGTTCACACAGAACCTGGCGCTGTTTGGAGCCCTTCTCTTCTTCCTGGGCATGA
AGAACTCGGTCCCCAAGAGGCAGGCCAAGAAGAAGGCCCCCAAGTCCAAGACAACTTAGATAGTTGCGGAGAAGACTCTTATTTAACAAAGAAGCTACCG
TACCTGGTTCTCTTATGTGTAATCGGATCCGTTTTTGAAGGGGGGTGCAGGCCTTACGAGGTGTGGGTGGCGGTTTAGGCGACTAGATTGTGTATCATTA
TTATTATGTGCTACTTCCGATTTGATTGTTGTAGGGCTAAAGATTGTTATCCCATTTGTT
page-top