Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig12
Contig Information
Length 656 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd3o03   
Homology (BLAST) Top Hit dehydrin-/LEA group 2-like protein [Lophopyrum elongatum]
Score 309
Evalue 9.76669e-27
Total Hit Count 322
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig12
AATTCGCTTCTCAACGACCAAGTGAGCTAGGTGAACTAGACTCAATCAATTTATATGCGGTGGAGTATTATTCTGCAAAGGTAGCGGCCGTAGGCAGACC
GGGCTTAGTTCAGTCCAGGCAGCTTCTCCTTGATCTTGTCCATGAAGCTCTTCTTCTCACCGGTCCCGTCGGTGCCGTGTGTCCCAGTGCCAGTTGTTTC
GTTGTGTCCTTGCTGCCCGCCGTCGGTGGCCGTGGTTCCATGCGTCTCCGTGCCGGTCATTCCAGTGTGTCCATGCTGCCCGTAGGTGCCAGCGGTCTGC
TGGTGGTCACCATGACCACCGGGGAGCTTCTCCTTGATGTTCTCCATGGCATCCTTCTTCTTGTCGATGCCACCGGTGCCCTGTGTTTCCTTATCGGTCA
CTCCGGTGTGTTCGTGCTGCCCGTAGGTGCCGCCAGTGGACGGGGTGCCATGTGTCGCCGTGTCAGTGNGNCCTTGCTGCCCAAANGTGTCACCGGTCTG
CTGGCGGTCATTGTGGCCACCGGGGAGCTTCTCCTTGGTGTTCTTCATGATGCCCTTCTTCTCGCCTGTGCCGCCTGTGCTNTACGCCTCTGTGTCAGTC
ACTCTANNGTGTCCGNCTGCCCATAGGNGCCGNCNGNGGCCNGNGAGNCATGCGTC
page-top