Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig11
Contig Information
Length 183 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd18g24   
Homology (BLAST) Top Hit ramosa 3-like protein [Phalaris canariensis] (no hit)
Score 173
Evalue 8.81529e-17
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig11
TAATATGAATCCATTACAATCACTTGCTTTTACAAATCAAGGATGAAACTCAATGACAATACGGAATGATCAGAGTTCACATATAGGATACAGCTATGAT
TTCTTTGCACTAACTTTTTTTCCTTAGCATGGCCAACTCAATATCACCATGTGTTAACATGCCNAAACTTCTCTCGGGCTTCG
page-top