Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig9
Contig Information
Length 733 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd13h17   
Homology (BLAST) Top Hit hypothetical protein OsI_10296 [Oryza sativa Indica Group]
Score 591
Evalue 2.46991e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig9
TTACACAGGGTCAACCTCCACGTTTTTGGCTAACAACTCAACTGCAGGTGATTTTACAGATAACATCTACATACAGTACATACACTGCATACCCCTAAAG
AAAAGTACATACACTGCATAATTCCAGTGCAATTGTTTCGTAGTAATAAACGTGACATTTCTAATGACATGCATCCATGAATGCAAGCGGAAGCGATTCC
ATCTTGCCCCTGGCGGGTCGATCAATCTAACGAGTAGCAGATCTGCTGGAACGCCGCGACGTGCTCCTCCCCGTTCGCGTCCGCCACTCCGCCGAAGTCC
ACGAAGGACTGCACGTACTGGTCGTCGATGCGCGCCACGGCGTCGCGGATGACGCCGACCACGCTGCCGTAGCTCGAGTTCAGGATGTCCCGGACCTGAA
GCCTTGGAAAAGCCCAGAGCACCATGTTCCCGAAGAAGTCCATCGGCACAGGAGGGTCGGCCCTACCCCTGCAGTTCACGGCCAGCCTCACCTTGGTGAA
CTCCTCCGGCTTCAGGCCCCGCGCCGCCGTGAGCTTCTTCCAGACGTGCGCTAGTAGGCACTGGAAGGTGCTGCAACGTGTGCCCACGCGGGATTTGAGG
TCGGCGACGAACTCGGCCGTGAAGTCCAGGGTGAGGTTTTTTATCCTATCCATGGGGACGACGGCGTAGGCGTCTCCATCTCCACACGTGAACTCCAGTG
ACCGGTGATCGAACACCGGCGTCGGCGTGATTC
page-top