Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig8
Contig Information
Length 711 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd5c01   
Homology (BLAST) Top Hit senescence-associated protein DH [Zea mays] >gi|54208706|gb|AAV31120.1| senescence-associated protein DH [Zea mays] >gi|194700856|gb|ACF84512.1| unknown [Zea mays] >gi|195639304|gb|ACG39120.1| senescence-associated protein DH [Zea mays]
Score 677
Evalue 2.46822e-69
Total Hit Count 149
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig8
CCTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCCTCACCGTCTTCGCCTTCGTCGTCACGCACAAGGGCACCGG
GGAGGCCGTCTCCGGCCGCGGATTCAAGGAGTACAGGCTCGGGGACTACTCCAACTGGCTGCAGAAGCGGGTGGAGAACGACAAGAACTGGAACAGGATC
AAGGGCTGCCTCCAGGACGCCAAGGTCTGCAAGTCGCTCGAGGACAAGACGGTCGACCAGTTCATGTCCTCCGATCTCTCCCCCATCCAGTCCGGCTGCT
GCAAGCCTCCGATCAGCTGCGGCTTCACCTACGTCAACAGCACGCAATGGACCGGCCCCGCCAAGTCGACGGAGCCCGACTGCGGCGCGTGGTCCAACGA
CGGGGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACCCTCAAGCGCAATTGGAAGCGCTCCGCCATCATCAACATCGTCTTCCTC
GTCTTCATCATCATTGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTACAAGCAGCAGGGCGCGTACG
CCTGATCGTTTGGCTCGGTTATTTATTGCTTGGATTGGATGGATGCGATCGTCGTGTCATTTTCATTCATCGTCGTGCTTCTCTTAGGATGGCCTGATCT
ACTTTGTACAG
page-top