Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig6
Contig Information
Length 205 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd15j09   
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 220
Evalue 9.2534e-17
Total Hit Count 259
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig6
TCTTATTTTTGGATGTACTCTGGAAGCCTCCTCCTCNTCCTCTCCTCCACGGTGGCGCGGACGATGCTTCANACGTTGATGGGCANGGGCTCGCCGTTCC
ACTCCTTGAGGCNCTCCATCATGGGGTCGATGAGCTTGTTCTGGCTGATGCCCAGGAAGACCTTGGTGCACTCCTCGCCGGGGGACAGCAGCTTCTCGCC
GGTGA
page-top