Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2
Contig Information
Length 723 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd15l15   
Homology (BLAST) Top Hit hypothetical protein OsJ_024137 [Oryza sativa (japonica cultivar-group)]
Score 517
Evalue 9.15547e-51
Total Hit Count 317
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2
CAATCAAGGATAAAACTCAATGACAATACGGAATGATCAGAGTTTACATATAGGATACAAATATGTTTCTTTGCACTAACTTTTTTTCCTTAGCATGGCC
AACTCAATATCACCATGTGTTAACATGCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCATTTGCTACTTCTCTTTACATCGGAACTATGGAGG
CGAATAACACAGAACCATAACCTAAACAAAACGCTAGGACAAAGCACATTTCAGATGTTTCTGGTAAGGGCATAAGGCTCCTGTCATGCCGCCTTATTGG
TTTGGCTTCAGGGCGGCATTCGGCCCCAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTGGTGTTGCATCAGAAGGAGAAGCTTGATATGGTG
CCTTTGCATGCAGACGATCCTTTCTCTTCTCAAGGAATCGGTGAAGTGACGCCTTTCTAGCAATTGGCAGATCAGAAGCATTCGGACGAGCAGACTTAGG
AGCAACAACCGGATCACTAGGCAAACTACTTGCCGGGGCCAGCACGGCCGTCTGGACCTTGGCGGTGTCTGCAGCAGTTGTGGTCGCAGAGACGTTCTGA
GCAACCGGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTGGCCTTGTCGGCTGGGAAATCGTTGAACACGAGCACCTTCCCACCATAGAAGATGGTCA
GCTGGCTCTTGTCTTCCTCCCTA
page-top