Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1
Contig Information
Length 753 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd4h07   
Homology (BLAST) Top Hit Os09g0299200 [Oryza sativa (japonica cultivar-group)] >gi|50725048|dbj|BAD33181.1| putative transfactor [Oryza sativa Japonica Group] >gi|50725525|dbj|BAD32994.1| putative transfactor [Oryza sativa Japonica Group] >gi|113631046|dbj|BAF24727.1| Os09g0299200 [Oryza sativa (japonica cultivar-group)] >gi|215737042|dbj|BAG95971.1| unnamed protein product [Oryza sativa Japonica Group]
Score 613
Evalue 7.28214e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1
GTGGGAGGCGAATCTCGTGAAATTCTCTCTCCACTGCTCGCCGGAAACCAAGAAATCGCCAACCCACGAATCTTCCCTCACAACCAGTCCACACCGCCGC
GCCAAGTCCCGATCTTGCCGGCCGAGCTACACTCCGGCCGTCGCCAGTTCCCCGGCTCGAGCCTCCCGCCGCGAATTCGGACGGCTCGTCGACCCTGCCT
TCCGCTCACCTGCAGCAAATGGAATCAGGTGAAAACAACATGGGCTCGAATGATGGACCAAACAGCAAAGCTAACTTGGCTGCGAGGCAACGCTTACGGT
GGACAGATGAGTTGCATGAACAATTTGTGGAGGCTGTTACTCAACTTGGCGGTCCTGATAGAGCAACTCCTAAAGGAGTTTTGAGAATTATGGGTACACC
AGGATTAACAATATACCATGTGAAAAGTCACCTACAGAAATACAGGCTAGCAAAGTACATTCCCGACTCTTCAGCTGATGGTAACAAGGCTGATAACAAA
GATCCAGGGGATTCACTAGCAGGACTTGATGGATCCTCTGGAATGCAGATATCTGAAGCCCTGAAGCTGCAGATGGAGGTCCAAAAGCGGTTGCATGAAC
AGCTCGAAGTACAAAGGCAGCTGCAGCTGCGAATCGAGGCACAGGGAAAGTACCTTAAGAAAATCATAGAAGAGCAGCAGCGTTTCGGTGGCGGTGGTAT
AAAGTCTGAAACACCTGGTGCAGGAGCTACTGTCACAGTGTCGAGCGATCAGT
page-top