Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2167
Contig Information
Length 2075 bp
Tissue Anther at meiosis
Clones 51 Clones [Download: CSV  ,  FASTA ]
whpc10f11    whpc1k03    whpc4g22    whpc5c03    whpc5j07    whpc7h08    whpc7l02    whpc8i13    whpc8l24    whpc9b20    whpc9h17    whpc9k08    whpc9k19    whpc9p13    whpc13h15    whpc15n20    whpc16i16    whpc16o19    whpc17b03    whpc18h21    whpc18l21    whpc19j15    whpc19m18    whpc20h17    rwhpc10f11    rwhpc1k03    rwhpc4g22    rwhpc5c03    rwhpc5i02    rwhpc5j07    rwhpc7h08    rwhpc7l02    rwhpc8i13    rwhpc8l24    rwhpc9b20    rwhpc9h17    rwhpc9j11    rwhpc9j23    rwhpc9p13    rwhpc13h15    rwhpc14g03    rwhpc15n20    rwhpc16i16    rwhpc16o19    rwhpc17b03    rwhpc18h21    rwhpc18l21    rwhpc19j15    rwhpc19m18    rwhpc20g06    rwhpc20h17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase >gi|1771782|emb|CAA67128.1| beta-amylase [Triticum aestivum]
Score 1504
Evalue 0
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2167
TTTTTTTTTTGAACACTTAGCAGCAGAAGCCTGGACGGCAGCTCCATTTATACTGCTAAAAACCTTCACAATCATTAAGTTATAAGCACAAACTGTTTTA
TTTGTTCACTCAAATACACACAGCAAAGTGGGACGGAGTTCCGATGAACTGCAGCTCATCGGAAAAGCATACAACCTCATGATTACCAGTACAATAGTAT
TGCCAGACTATATGGCTATAACATTGTAGTACACAGTTTATTTATCCTCGGCGGCTTATTTCCTGTGCACCTCAATTCTCAGAAAGCACGTCTTGACCCT
CTTGTAGACTGCATCAGTGATGCACATTATTTTATGAAGATAGAGAAAGATTTCTACACAGGGGCAACGAGCACCTCATCCCCGACATCAGTGTGATCTT
TAACTGGCAGGTCGGTATTCTTATCAAAGGGGAATGGCTCCAGTTTTGGCTGCGCTGCTTTCAGGATCATTTCAATTGGCATTTCTGGCTTTGATCTTTC
CAAAGGCGCCACTGGATCAACACTTGGGTCATGACCCAGGTTAGCATGCATTTTCTCAACAAAAGTTTGGAAAGTGGCATAGTTCTGTCCCTCCAGTAGC
TCATTCGATAACCGGAGGTAGGTGAATCCAAACAGTTTGTGCTCAGGAGGGCCATTCTTGTTGATGCCTTTCGGCCTCGCATTCCTGAGTATTGTGTTGT
AAGCAGTGGCATCATATCGACCGAGTGCGTTTTCGCACGCCACATGTAAACCCTCTCTCCATCCAGCACTCAGCACCTGTTGGACTAGTTCTTCTGGTGC
GCTCTTCGCCTCTTCGCTTTGCTCGGAGTCCCTCATCTCTGCACAAGTGAAGTTCATGCTAGCATGATGCCTTGTGAGCATGCGTGCTATGGTTCTGTAG
CCGTCTCTGTCATCTAAGTTGTAGTACCCAGCTGTGAGCTCGGCTGCATGGTTTGGAACCCTGTACCACCAGTGAATGCCAGAGATTTTGATTGCCAGCT
GCACCCTGCATCCCAAGAAGACCTTGTTTGCTTCGTCCAAGATCTTGTCACCGTGCTTGATCAGTTTGTTGGAGTACCATGACAGGAAAAACTTCCCCTT
CTCTGTGAGGTATGTTCCGTTGTCCTTGAAGAATTGGGTTTTCTCGGGAGTGTCGTTGTACTCTCCAGCATCGTCAGGCAATTCCCACTCAGGGGTGGCC
AGCCTTCGCCGCTGCTGCTTTGAAGTCTGCTTCCAGGTACTTATCATAACAGATGAATTCTCCGATGCCTGGGAAGACCCATGCCTTGGCTCTGAGGATA
CGATGGGTACCTCATCTCTCCAGCTGGGCCAAGTCCCACTTCAATGTCCACGATGGTACCGGCATCCAAGAACTTCTTCATGTTTTCCCTGAAGCTCGCC
ATGTAATCAGCATACATCTGGACGGCAGTTCTTCCATGGAAGAGAGGCTGGTCGTCCACTCCAAGGGTGAGGTACTCGATGTTCCTCGTCCCGCCGCGGT
TGGTGTAGAAAATGTCGGGGTCGGTGGCGCCGACGTCGCGAACCCACTGTGGGATGGGGATGTTGACGACGTCGCCGACGTTGCCACCGCACTGGTGGAA
TGACATGATGGCCTGCAGCTTGAGCCCGGCCTCGTGCACCAGGTCGAAGACCTGCTTGTAGGCGCTCCAGTCGTACGCCTTGGGGCCCTTGCCCTCCACC
AGCCCCCACCAGACGTCTATCATGACGCCGTCCACGCCGGCCTCCGTCAGCTTCTTCAGCTGCGCCCTGATCTCGTCGCCCTTCTCGAATTTGTTGTCGA
CGCTCACGACGTCCAGCTATTCCCACAACGAAAGTGAAGGCAAGGTTAGTGGAACTACTGCATCTGAGGTCTCAGATCAGATCTTGTTGATAAGCTGGGT
ATCATATGCATGATAATGTGAGTTTTTAGATCCTTGGAATGGTTTGTCAGTGCCATGGTGCTTAGCGGGCTGAATGGAGCTTACCGGGAGCATGACGTAG
ACTTGGACATAGTTGGCTAGCATGTTCCCGGCCATTGTGGCTGCTGGCTACAAACACTGGCTTGCGTGCTCACTC
page-top